جستجوجستجو
تبلیغات
تبلیغات متنی
فروشگاه کامپیوتر فیض

نازلترین قیمت بازار در حوزه کامپیوتر و لوازم جانبی

تبلیغات
تبلیغات
عبارت های جستجو شدهعبارت های جستجو شده
(میکرو ار ان ای) 

پرسشکده > دسته بندی نشده
پیوند همیشگی پرسش
    
چگونه می توان تراز های ممکن (alignment) بین دو رشته دی ان ای (DNA) یا ار ان ای (RNA) را پیدا کرد؟ به عنوان مثال چگونه می توان یک میکرو ار ان ای (miRNA) را با یک مسنجر ار ان ای هدف (mRNA) تراز کرد؟
hamed در تاریخ 1 آذر ماه سال 1389 در ساعت 10:37 ب.ظ این سوال را پرسیده است.

تعداد بازدید: 1811
گزارش تخلف
پیوند همیشگی پاسخ
برای تراز کردن دو رشته از نوکلئوتید ها می توانید از نرم افزار miRanda استفاده کنید. این نرم افزار دو رشته را به عنوان ورودی دریافت می کند و به دنبال تراز های مناسب رشته اول در رشته دوم می گردد. ترازبندی این نرم افزار از نوع مستقیم نیست بلکه از نوع مکمل است. به عنوان مثال بجای پیدا کردن جفت های A:A یا G:G به دنبال جفت های A:T و G:C می گردد.

این نرم افزار کدباز (open source) می باشد و فایل اجرایی کامپایل شده برای انواع مختلف سیستم عامل ها وجود دارد. فایل اجرایی ورژن 1.9 این نرم افزار هم توسط یکی از اعضای سایت به نام سهیل جهانگیری به پرسشکده هدیه شده است.سهیل در زمینه لینوکس خیلی حرفه ایه و بخاطر این لطفش ازش تشکر می کنیم.

دانلود فایل اجرایی نرم افزار میراندا برای سیستم عامل ویندوز
Download miRanda 1.9 for Windows - cygwin

نمونه خروجی نرم افزار miRanda را در اینجا مشاهده می کنید. این قسمتی از فایل خروجی است که در آن یک تراز (alignment) به همراه مشخصات آن نمایش داده شده است.
  

Forward:    Score: 114.000000  Q:1 to 22  R:886 to 906 Align Len (21) (80.95%) (85.71%)

   Query:    3' GTCGAAAGTTTTACTAGAGTG 5'
                || : |||||| |||||||||
   Ref:      5' CA-TATTCAAATTGGTCTCAC 3'

   Energy:  -20.030001 kCal/Mol

Scores for this hit:
>embl|AJ550546|DME550546    embl|U31226|DM31226    114.00    -20.03    0.00    1 22    886 906    21    80.95%    85.71%



کنجکاو در تاریخ 1 آذر ماه سال 1389 در ساعت 10:56 ب.ظ به این سوال جواب داده است.





پرسش های مرتبط:
الگوریتم نرم افزار میراندا (miRanda) برای شناسایی تراز ها (alignment) چیست؟ چه پارامترهایی دارد؟ از چه روشی استفاده کرده است؟
بر روی یک کامپیوتر دو کارت شبکه (LAN یا Wireless) وجود دارد. یکی از شبکه ها به اینترنت متصل است ولی شبکه دیگر اینترنت ندارد. چگونه می توان ویندوز را تنظیم کرد بگونه ای که بتوان در آن شبکه هم اینترنت داشت؟
همانگونه که می دانید سیستم استدلال رویه ای PRS یکی از اولین ساختارهای پیشنهادی مبتنی بر BDI بوده است. در این سیستم کتابخانه از پیش تعریف شده ای از طرح ها (Plans) موجود است و هر طرح اجزا زیر را دارد:
A goal: pas condition  of the plan
A context: precondition of the plan
A body: recipe - courses of actions
در این ساختار در قسمت بدنه بجای توالی عمل ها می توان مجددا goal تعریف نمود یعنی در این مرحله از توالی عمل ها باید این هدف حاصل شود و سپس بقیه هدف ها ادامه یابد. در این مدل حتی می توان از حلقه یا عملگر های and و or نیز استفاده کرد. در این سیستم یک پشته از اهداف (intention stack) وجود دارد و در ابتدا یک هدف اولیه در این پشته قرار می گیرد و بر حسب اینکه کدام طرح ها می توانند به این هدف نائل شوند (و پیش شرط های آن در حال حاضر موجود است) یکی از طرح ها با مکانیزمی انتخاب و اجرا می شود. اجرای هر طرح ممکن است مستلزم قرار دادن هدف ثانویه ای در پشته باشد. نمونه ای از این سیستم که برای جابجا کننده بلاک ها نوشته شده است در زیر نشان داده شده است. مشابه همین سیستم را برای مسئله میمون و موز بنویسید.

GOALS:
ACHIEVE blocks_stacked;
FACTS:
FACT ON "Block5" "Block4";           FACT ON "Block5" "Block3";
FACT ON "Block1" "Block2";           FACT ON "Block2" "Table";
FACT ON "Block3" "Table";            FACT CLEAR "Block1";
FACT CLEAR "Block5";                  FACT CLEAR "Table";
Plan: {
     NAME: "Top-level plan"
     GOAL: ACHIEVE blocks_stacked;
     CONTEXT:
     BODY:
ACHIEVE ON "Block3" "Table";
ACHIEVE ON "Block2" "Block3";
ACHIEVE ON "Block1" "Block2";
}

Plan: {
     NAME: "Stack blocks thar are already clear"
     GOAL: ACHIEVE ON $OBJ1 $OBJ2;
     CONTEXT:
     BODY:
ACHIEVE CLEAR $OBJ1;
ACHIEVE CLEAR $OBJ2;
PERFORM move $OBJ1 $OBJ2;
     UTILITY: 10;
     FAILURE: EXECUTE print "\n\nStack blocks failed!\n\n";
}

Plan: {
     NAME: "Clear a block"
     GOAL: ACHIEVE CLEAR $OBJ;
     CONTEXT: FACT ON $OBJ2 $OBJ;
     BODY:
ACHIEVE ON $OBJ2 "Table";
     EFFECTS: RETRACT ON $OBJ2 $OBJ;
     FAILURE: EXECUTE print "\n\nClearing block failed!\n\n";
}

اگر عمل های صادر شده از طرف یک عامل در مثال ماشین جاروگر به شکل غیرقطعی باشد (یعنی بر اساس یک تابع تولید حرکت تصادفی که به نویز محیط بستگی دارد، حرکت از یک خانه گاهی اوقات به خانه ای کاملا متفاوت و پیش بینی نشده صورت پذیرد)، اثر  این موضوع بر روی نتیجه کار عامل چه خواهد بود؟ برای منظور نمودن این وضعیت چه تغییراتی را در الگوریتم مربوطه پیشنهاد می کنید؟
چگونه می توان با کد C# یک فایل صوتی را در یک RichTextBox ذخیره کرد؟

چاپ اعلان ارسال برای دوستان مشترک شوید اضافه به دوست داشتنی ها پرسشکده خانه من باشد


کلیدواژه



 
Poseshkadeh on Google+ Porseshkadeh on Twitter Porseshkadeh on Facebook Porseshkadeh RSS Feed